Mutational activation of the phosphatidylinositol 3-kinase (PI3K) pathway occurs in a wide variety of tumors whereas activating Wnt pathway mutants are predominantly found in colon cancer. model signals transduced through different pathways are integrated at the level of the regulatory elements of individual genes. Such regulatory elements may be viewed as assemblies of cis-acting response elements that are tailored to create the unique expression pattern for each gene. However numerous studies propose that signaling pathways may interact at any stage between the plasma membrane and the nucleus. One mechanism by which such cross-talk 4EGI-1 may occur entails the sharing of a common component between two different pathways. It is often tacitly assumed that such shared components are equally accessible to all relevant pathways. Glycogen synthase kinase 3-α and -β collectively termed GSK3 are constitutively active serine/threonine kinases (1). GSK3 features in two signaling pathways that are of particular importance in malignancy. GSK3 is usually a downstream component of the phosphoinositide 3-OH kinase (PI3K)2 pathway (2 3 Growth signals activated Ras proteins or loss of the phosphatase and tensin homolog (PTEN) all activate PI3K which in 4EGI-1 turn phosphorylates and activates protein kinase B (PKB) (3). Active PKB phosphorylates GSK3α on Ser-21 (4) and GSK3β on Ser-9 (5) in both cases leading to inhibition of the constitutive kinase activity. GSK3 is also a component of the Wnt cascade (6). GSK3 is usually bound by Axin (Axis inhibition protein) (7) and phosphorylates β-catenin thus targeting it for ubiquitination and degradation by the proteasome. Wnt signaling is usually assumed to block GSK3-mediated β-catenin phosphorylation leading to the accumulation and nuclear translocation of β-catenin (6). It remains unclear how the Wnt cascade controls the activity of the dedicated Axin1-bound GSK3 pool. A recent genetic experiment has exhibited that removal of the inhibitory serines from the two GSK3 proteins has no effect on Wnt signaling (8). Although an early study proposed that the two pathways do not cross-talk at the level of GSK3 (9) a multitude of papers have since appeared that are based on the premise that a single pool of GSK3 is usually targeted by both signals (observe supplemental Table S1). Moreover direct stabilization of β-catenin by the PI3K/PKB pathway has been claimed in several additional studies (observe supplemental Table S1). Mutational activation of the Wnt pathway through loss of adenomatous polyposis coli protein (APC) Axin1/2 or through point mutations in β-catenin occurs in a limited diversity of cancers most notably of the intestine (6) and it 4EGI-1 is characterized by stabilized β-catenin and constitutive transcriptional activity of β-catenin-TCF complexes in the nucleus. This can be readily read out by the constitutive activity of β-catenin/TCF reporters such as pTOPFlash (10). Mutational activation of the PI3K pathway occurs in a wide variety of tumors through mutational activation of any of the Ras genes v-murine sarcoma viral oncogene homolog B1 ((3). If GSK3 would indeed represent a focal point of cross-talk between the two pathways β-catenin/TCF-driven transcription would Rabbit polyclonal to PNPLA8. be activated in tumors harboring PI3K-activating mutations. This has major implications for our thinking around the molecular pathogenesis of malignancy. EXPERIMENTAL PROCEDURES Q Descendants Migration Count in 4EGI-1 Caenorhabditis elegans The final positions of the Q descendants was scored using a mec-7::gfp (muIs32) reporter transgene (11). All assays were performed at 20 °C. The gene knock-out project at the Oklahoma Medical Research Foundation) was detected by PCR using the following primers: daf-18int-in (CAACGCAGTACATCTCGAAGCC) and daf-18int-out (CCAGCTGATACCGATGATGTTGAT). Cells and Cell Culture HEK293T cells were managed in RPMI 1640 medium (Invitrogen) supplemented with 5% fetal calf serum. All malignancy cell lines used in this study are outlined in Table 1. The prostate malignancy cell lines LNCaP and PC3 were the kind gifts of Dr. J. Trapman and were cultured in RPMI 1640 medium with 10% fetal calf serum. The breast malignancy cell lines EVSA-T and SK-BR-5/7 were the kind gifts of Dr. N. DeVleeschouwer (Institute Jules Brodet Brussels Belgium) Dr. H. S. Smith (California Pacific Medical Center San Francisco) and Dr. E. Stockert (Sloan-Kettering Institute for Malignancy Research New York) respectively. The SUM series cell lines were generated in the Ethier laboratory (available on collection). The cell collection OCUB-F was obtained from Riken Gene Lender (Tsukuba Japan). All other cell lines were obtained from American Type Culture Collection.