We generated a strain of in which the sole source of -tubulin protein has a cys-to-ser mutation at cys-377, and then we examined microtubule morphology and nuclear positioning through the cell cycle. palmitoylated -tubulin GSK1120212 distributor in C377S cells. Our results suggest that cys-377 of -tubulin, and possibly palmitoylation of this amino acid, plays a role in a subset of astral microtubule functions during nuclear migration in M phase of the cell cycle. INTRODUCTION Microtubule functions in are apparently simpler than CAPN1 those in higher eukaryotes (reviewed in Solomon, 1991 ). Previously identified microtubule-dependent functions in this yeast are chromosome separation during mitosis, as well as nuclear migration during mitosis and mating. However, within this GSK1120212 distributor relatively limited repertoire, microtubules perform complex functions, forming reversible associations with the cell cortex at precise locations and times during the cell cycle (Goode [pWK83; pQX3]Weinstein and Solomon, 1990 ?JFY2705[pRB539]This study? LTY496[pLJS214]This study? LTY429[pLJS377]This study?JBY212[pJB2137]This studyPlasmids?pWK83were designed to change amino acid 377 or 214 from cysteine to serine. To create pLJS377, we used the primer CACAATTGGCTACTGTGGATAGGGCCGTCTC-TATGTTGTCAAATACC, which changed codon 377 from TGC (Cys) to AGC (Ser) and introduced a silent mutation that removed an MscI site. To create pLJS214, we used the primer GCTATTTACGACATGAGCAAAAGAAACTTGGACATCCCAAGACC, which changed codon 214 from TGT (Cys) to TCT (Ser) and introduced a silent mutation that removed an mutations were introduced. To create the double mutant plasmid (pJB2137), pLJS214 was cut with in the vector. The plasmid was sequenced to confirm that the correct mutations were introduced. Four plasmids (and the three plasmids) were transformed separately into the haploid strain DBY2384 that was deleted for both and plasmid to provide -tubulin function. Plasmid shuffle (Boeke plasmid with either or plasmids. Transformants were streaked onto 5-fluroorotic acid (5-FOA) plates to select for loss of the plasmid (Boeke (strain LTY430), C214S GSK1120212 distributor (strain LTY496), C377S (strain LTY429), or C214S/C377S overexpressor plasmid (pJFS377), pQX3, which contains gene, was purified. This fragment was missing the 3 end of the gene, including the coding region for cys-377. pLJS377 was cut with mutation was purified. The C377S fragment was ligated into the fragment. The resulting GSK1120212 distributor construct was sequenced to confirm that the correct mutation was introduced. The diploid strain FSY279 was streaked onto 5-FOA plates to select for loss of the plasmid (pQX3). Cells were then transformed with three different plasmids. Transformed strains were maintained in synthetic complete (SC) medium (?U, ?L). To assess galactose induction of Tub1p and C377S tub1p synthesis, strain FSY279 (containing the plasmid) and strains containing the plasmids were grown for up to 4 h in SC (?U, ?L) and 2% galactose. At several time points, cells were lysed and extracts were assayed for relative levels of – and -tubulin by SDS-PAGE and immunoblot analysis. Strain JFY2705 produced similar levels of -tubulin as strain FSY279 at all time points. After 4 h in the presence of galactose, -tubulin levels increased by approximately fivefold and -tubulin increased by approximately twofold in both strains. Microscopy Microtubules were visualized with the use of the rat monoclonal anti-tubulin antibody YOL1/34 and fluorescein isothiocyanate-labeled goat anti-rat antibody (Rose for 10 min at 4C. Protein concentrations of resulting supernatants were determined with the DC Protein Assay kit (for 10 min followed by 100,000 for 60 min at 4C. DEAE chromatography was performed as described by Barnes (1992) with some modifications. All procedures were performed at 4C. Glycerol and NaCl were added to supernatants to final concentrations of 10% and 0.1 M, respectively. Supernatants (2.2 mg of protein per strain) were loaded onto 1-ml columns of DE-52 resin (Whatman, Clifton, NJ) equilibrated with column buffer (0.1 M PIPES, pH 6.8, 10 mM MgSO4, 2 mM EGTA, 0.1 mM GTP, 0.1 M NaCl, 10% glycerol, 1% Triton X-100, and protease inhibitors). The column was washed with 5 volumes of column buffer. Tubulin was eluted with 2 volumes of bump buffer (0.1 M PIPES, pH 6.8, 10 MgSO4, 2 mM EGTA, 0.1 mM GTP, 0.6 M NaCl, 10% glycerol, 1% Triton X-100, and protease inhibitors). Fractions (100 l) were collected. Duplicate samples of each fraction were subjected to SDS-PAGE followed by either Coomassie blue staining or immunoblot analysis of -tubulin levels. Fractions containing tubulin were pooled and proteins were concentrated by chloroform/methanol precipitation (Wessel and Flgge,.