Randomly amplified polymorphic DNA analysis using primer 239 (5′ CTGAAGCGGA 3′) was performed to characterize sp. aswell as in other fields of applied microbiology. Randomly amplified polymorphic DNA (RAPD) analysis has been shown to be suitable for generating strain- and species-specific oligonucleotide probes and/or primers with known sequences (3 6 10 Therefore the developed RAPD-PCR method was applied to find a significant RAPD fragment within subsp. strains. Moreover a set of primers to use in PCR amplification was designed in order to evaluate its suitability as a specific probe for identifying subsp. subsp. subsp. spp. These strains were isolated from such different sources as pizza dough field grass natural whey cultures mozzarella cheese and sausages. FIG. 1 RAPD patterns of different leuconostoc species generated with primer 239 (5′ CTGAAGCGGA 3′). The bold arrows show the location of the 1.1-kb band. (A) Lane a sp. strain DSM 20186; lane b DSM WNT16 20188; lane c … Preparation of crude cell extracts and RAPD-PCR assays under standard conditions were carried out as previously described (5). In brief 28 different 10-mer primers were tested initially by screening of DNA from the 13 Anisomycin leuconostoc strains belonging to the DSM in RAPD-PCR assays. The suitability of each primer was scored on the basis of intensity and distribution of bands. Experiments indicated that primer 239 (5′ CTGAAGCGGA 3′; Primm Milan Italy) allowed reproducible patterns with bands from 0.5 to 3 kb to be generated (results not shown). Its ability to Anisomycin generate the same pattern was evaluated by amplifying DNA from the DSM leuconostoc strains three times with the same RAPD conditions. Therefore this primer was used to differentiate all of the 66 leuconostoc strains. Representative RAPD profiles are shown in Fig. ?Fig.1.1. Primer 239 produced 11 different RAPD patterns among the 13 strains of the DSM since DSM 20346T and DSM 20200 of subsp. (Fig. ?(Fig.1A 1 lanes f and g respectively) and subsp. DSM 20484T (Fig. ?(Fig.1A 1 lane h) exhibited the same profile. The RAPD pattern of subsp. DSM 20343T (Fig. ?(Fig.1A 1 lane e) revealed two major bands of 1 1.1 and 1.7 kb which also occurred in subsp. strains A52 A65 11 23 and 27X. All the other subsp. strains tested (with the exception of strains 574 and A27) and sp. strain 511 Anisomycin exhibited RAPD profiles with only a DNA fragment amplified at about 1.1 kb. This significant band was absent in all other strains of the genus subsp. DSM 20343T. It can therefore represent a misidentification. The subsp. A27 and A72 and A57 strains displayed the same RAPD pattern with only the fragment of 1 1.7 Anisomycin kb. This result could be attributed to the lack of the homology sequence with the 239 primer on the genome of these strains located after 1.1 kb from the first site of annealing. A misidentification for the A72 and A57 strains could be supposed because their RAPD patterns were strongly different from that of the type strain of subsp. lacking galactose fermentation. The 1.1-kb DNA fragment from DNA of subsp. DSM20343T that was amplified by primer 239 was cloned into the pCR-Script SK(+) cloning vector (Stratagene La Jolla Calif.) and the DNA Anisomycin sequence of the whole fragment was determined by the dideoxy chain termination method (7) by using the DNA sequencing kit (Perkin-Elmer Cetus Emeryville Calif.) according to the manufacturer’s instructions. Research for DNA homologies performed with the GenBank and EMBL databases revealed less than 20% homology to any known sequences. Two oligonucleotides (LMMf: 5′ CCGTTACCCCTAAATTTTGAC; LMMr: 5′ GACCAAATACAATAGGTTGCG) were chosen inside (positions 139 to 160 and 944 to 965 respectively) the 1 151 sequenced fragment to increase the stringency in the specific amplification of DNA from subsp. strains. PCR was performed at 94°C for 3 min followed by 25 cycles of 1 1 min at 94°C 45 s at 67°C and 1 min at 72°C and a 5-min extension period at 72°C. Representative results of all the strains tested for PCR specificity with the selected primers are shown in Fig. ?Fig.2.2. Twenty-one of 22 subsp. strains strains A72 and A57 (formerly reported as sp. strain 511 exhibited Anisomycin a PCR fragment located at 825 bp. No DNA amplification was observed in strain 574 in 42 strains belonging to other leuconostoc species or in two reference strains.